information.
the hardest thing for all of us to pass on to others is information.
data is easy - well it has *become* easy. what that data means is hard to pass on. very hard.
this is the the trial for everything we do. the massive undertaking to pass on knowledge, experience and basic information to all of the people that need to KNOW is why we are all here...and you know what?
its really bloody hard. next to impossible. its what we will spend most of our lives doing - and you think that we would evolve new techniques in communication at some point to assist this. but no.
same bloody language, same limitation of words and concepts - same problems with new words/phrases that come up daily to describe something that's otherwise difficult to describe.
its very frustrating.
i think we should come up with a technique of discussion which is multitasked. for example - what if all of us could use sign language? we could discuss one topic while speaking on another at the same time. or we could speak to two people, or we could have subtext, highlighting points we are talking about..
sounds difficult? i think if it was introduced early enough it would be easy. the immediate effect - there would be an immediate increased throughput of information..
of course the signal to noise ratio wont improve, but hey.
whatever.
next problem: common sense.
the hardest thing for all of us to pass on to others is information.
data is easy - well it has *become* easy. what that data means is hard to pass on. very hard.
this is the the trial for everything we do. the massive undertaking to pass on knowledge, experience and basic information to all of the people that need to KNOW is why we are all here...and you know what?
its really bloody hard. next to impossible. its what we will spend most of our lives doing - and you think that we would evolve new techniques in communication at some point to assist this. but no.
same bloody language, same limitation of words and concepts - same problems with new words/phrases that come up daily to describe something that's otherwise difficult to describe.
its very frustrating.
i think we should come up with a technique of discussion which is multitasked. for example - what if all of us could use sign language? we could discuss one topic while speaking on another at the same time. or we could speak to two people, or we could have subtext, highlighting points we are talking about..
sounds difficult? i think if it was introduced early enough it would be easy. the immediate effect - there would be an immediate increased throughput of information..
of course the signal to noise ratio wont improve, but hey.
whatever.
next problem: common sense.
GAATACAAGCTTGGGCTGCAGGTCGACCAAACATTAGATGGGGCGCGTGGTGGCGGCT
GCAGCCGCCACCACGCGCCCCTCGAGCTTAGGGTACCGTTCAGATAGCCACCATGGAA
Paste it here and it makes a fun shape (fold RNA and then choose a structure *jpg*).
And that is the end of this dorkiness. Did I tell you that you rock. Oh yes, I did. Well, keep up all you're good work!
[Edited on Jan 15, 2004 2:13PM]
THANK YOU THANK YOU THANK YOU.